Fig. 6. H7 inhibits IL-4-stimulated transcription of Stat6-RE reporter construct. / Luciferase construct from human Igε promoter containing 3 repeats of Stat6 binding sites (3 × AATCGACTTCCCAAGAACAG) (Stat6-RE) and 4 repeats of C/EBP binding sites (4 × GCTGTTGCTCAATCGAC) (C/EBP-RE) were analyzed. (A) Stat6-RE and Igε reporter constructs were transfected into COS-7 cells, together with β-galactosidase and Stat6 expression vectors. (B) C/EBP-RE reporter construct was transfected into HepG2 cells, together with β-galactosidase expression vector. O/N-starved cells were treated with IL-4 (10 ng/mL) and H7 (100 μmol/L), as indicated. β-Galactosidase and luciferase values were measured. Luciferase values were normalized against β-galactosidase, and mean values of 3 (A) and 7 (B) independent experiments with SD are shown.
Fig. 6.

H7 inhibits IL-4-stimulated transcription of Stat6-RE reporter construct.

Luciferase construct from human Igε promoter containing 3 repeats of Stat6 binding sites (3 × AATCGACTTCCCAAGAACAG) (Stat6-RE) and 4 repeats of C/EBP binding sites (4 × GCTGTTGCTCAATCGAC) (C/EBP-RE) were analyzed. (A) Stat6-RE and Igε reporter constructs were transfected into COS-7 cells, together with β-galactosidase and Stat6 expression vectors. (B) C/EBP-RE reporter construct was transfected into HepG2 cells, together with β-galactosidase expression vector. O/N-starved cells were treated with IL-4 (10 ng/mL) and H7 (100 μmol/L), as indicated. β-Galactosidase and luciferase values were measured. Luciferase values were normalized against β-galactosidase, and mean values of 3 (A) and 7 (B) independent experiments with SD are shown.

or Create an Account

Close Modal
Close Modal